shenjean

Landscape of Interacting Microbes - PCR Protocols

LIM lab | Home | People | Publications | News | Lab Manual | Contact | Protocols

Metabarcoding of the V4 region (515F/806R) of the prokaryotic 16S rRNA gene

Primer	Sequence	Amplicon size
515F	*[CS1] - GTGCCAGCMGCCGCGGTAA	291 bp
806R	**[CS2] - GGACTACHVGGGTWTCTAAT	291 bp

*Fluidigm tag [CS1] (ACACTGACGACATGGTTCTACA)
**Fluidigm tag [CS2] (TACGGTAGCAGAGACTTGGTCT)

DNA preparation

• Dilute all DNA samples with DNA-grade Water to 1-10 ng/µL.
• Amplify the V4 region of the prokaryotic 16S rRNA gene from 1 µL of each diluted DNA sample using conditions recommended by Michigan State University’s (MSU) Research Technology and Support Facility (RTSF):

Reagent	Volume
PCR-grade water	8.1 µL
AmpliTaq Gold 360 Master Mix (2x)	12.5 µL
Primer 515F (10 µM)	1.2 µL
Primer 806R (10 µM)	1.2 µL
GC enhancer	1.0 µL
Template DNA	1.0 µL
Total reaction volume	25.0 µL

Thermocycling conditions

Temperature	Time	Repeat
95 °C	10 min
95 °C	45 s	x30
50 °C	60 s	x30
72 °C	90 s	x30
72 °C	10 min
11 °C	hold

Post-PCR

• From each reaction, 10 µL of PCR products will be visualized on a 2% (wt/vol) 1xSB agarose gel ran at 170V for 45 minutes
• The gel will be stained with ethidium bromide or SYBR Safe
• DNA samples that did not produce visible PCR products will be re-amplified using the original, undiluted DNA, using more template DNA, or increasing the number of cycles (max 42 cycles)
• PCR products will be purified using the Zymo Research Clean & Concentrator kits
• Purified PCR products will be quantified using the Qubit DNA HS assay
• Purifiied PCR products will be diluted to 1-10 ng/uL, arranged in 96-well plate(s) and submitted, along with annotated gel images, for amplicon sequencing by MSU RTSF on the AVITI 2x300 bp platform.