Landscape of Interacting Microbes - PCR Protocols
LIM lab | Home | People | Publications | News | Lab Manual | Contact | Protocols
- The fungal/microeukaryotic ITS region will be amplified with ITS3F/4R primers with Fluidigm tags attached to the 5’ end.
- Primers and thermocycling conditions are based on the protocol
for Zymo’s Quick-ITS Plus NGS Library Prep Kit
| Primer |
Sequence |
Amplicon size |
| ITS3F |
*[CS1] - GCATCGATGAAGAACGCAG |
250-600 bp |
| ITS4R |
**[CS2] - TCCTCCGCTTATTGATATGC |
250-600 bp |
*Fluidigm tag [CS1] (ACACTGACGACATGGTTCTACA)
**Fluidigm tag [CS2] (TACGGTAGCAGAGACTTGGTCT)
DNA preparation
If yields are low, PCR reactions can be performed in duplicates or triplicates, then combined and purified.
| Reagent |
Volume |
| PCR-grade water |
7.1 µL |
| AmpliTaq Gold 360 Master Mix (2x) |
12.5 µL |
| Primer 515F (10 µM) |
1.2 µL |
| Primer 806R (10 µM) |
1.2 µL |
| GC enhancer |
1.0 µL |
| Template DNA |
2.0 µL |
| Total reaction volume |
25.0 µL |
Thermocycling conditions
| Temperature |
Time |
Repeat |
| 95 °C |
10 min |
|
| 95 °C |
30 s |
x35 |
| 55 °C |
30 s |
x35 |
| 72 °C |
90 s |
x35 |
| 72 °C |
10 min |
|
| 11 °C |
hold |
|
Post-PCR
- From each reaction, 10 µL of PCR products will be visualized on a 2% (wt/vol) 1xSB agarose gel ran at 170V for 45 minutes
- The gel will be stained with ethidium bromide or SYBR Safe
- DNA samples that did not produce visible PCR products will be re-amplified using the original, undiluted DNA, using more template DNA, or increasing the number of cycles (max 42 cycles)
- PCR products will be purified using the Zymo Research Clean & Concentrator kits
- Purified PCR products will be quantified using the Qubit DNA HS assay
- Purifiied PCR products will be diluted to 1-10 ng/uL, arranged in 96-well plate(s) and submitted, along with annotated gel images, for amplicon sequencing by MSU RTSF on the AVITI 2x300 bp platform.